View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2824_high_3 (Length: 333)
Name: NF2824_high_3
Description: NF2824
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2824_high_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 13 - 319
Target Start/End: Original strand, 37544899 - 37545211
Alignment:
| Q |
13 |
tgagataaagccacatgtgacacaaaattccctaatctctcatcattatgcgttgacagataatcctacgctcaaggcgcatagatagccaatcaaatgg |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||| ||| ||| |||||||||| |||||||||||||||| |||| ||||||||||| |
|
|
| T |
37544899 |
tgagataaagccacatgtgacacaaaattcccttatctctcatcattgtgcattggcagataatcccacgctcaaggcgcataaatagtcaatcaaatgg |
37544998 |
T |
 |
| Q |
113 |
tgtcaatgcattaattagaatcatgtgtgaggcatgtttgcaacctaagtttatctatataa------tttcacccataagtgaaggatccgactttaac |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
37544999 |
tgtcaatgcattaattagaatcatgtgtgaggcgtgtttgcaacctaagtttatctatataaacctagtttcacccataagtgaaggatccgactttaac |
37545098 |
T |
 |
| Q |
207 |
gcctctgaggttcaaggtgtgatccaacaaccataaggtaacatttttaaaggcttgaaattgaaaacaagttttaagataaaaccatttgtttattatt |
306 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
37545099 |
gcctctgaggttcaaagtgtgatccaacaaccataaggtaacatttttaaatgcttgaaattgaaaacaagttttaagataaaacactttgtttattatt |
37545198 |
T |
 |
| Q |
307 |
atcatgtgtatct |
319 |
Q |
| |
|
||||||||||||| |
|
|
| T |
37545199 |
atcatgtgtatct |
37545211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University