View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2824_low_6 (Length: 247)
Name: NF2824_low_6
Description: NF2824
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2824_low_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 227; Significance: 1e-125; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 231
Target Start/End: Original strand, 54456819 - 54457049
Alignment:
| Q |
1 |
gcggatagagttggaggatgaagtgaggagggagcttgcaatggagggggcgtttggaactatgcagaagcctctcaattctgtgtggtcaaattctaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54456819 |
gcggatagagttggaggatgaagtgaggagggagcttgcaatggagggggcgtttggaactatgcagaagcctctcaattctgtgtggtcaaattctaca |
54456918 |
T |
 |
| Q |
101 |
ccgatgatgatgatgaaccctgttgctgttgatgcttcacaaccacctgaaatcaaacattttccacagaccagtggcaaggacaaagttattctattgg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
54456919 |
ccgatgatgatgatgaaccctgttgctgttgatgcttcacaaccacctgaaatcaaacattttccacagaccagtgacaaggacaaagttattctattgg |
54457018 |
T |
 |
| Q |
201 |
tcagtttcgtaactttttctattctcttctc |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
54457019 |
tcagtttcgtaactttttctattctcttctc |
54457049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 1 - 104
Target Start/End: Original strand, 54056498 - 54056601
Alignment:
| Q |
1 |
gcggatagagttggaggatgaagtgaggagggagcttgcaatggagggggcgtttggaactatgcagaagcctctcaattctgtgtggtcaaattctaca |
100 |
Q |
| |
|
|||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||| | ||||||||||||||| |
|
|
| T |
54056498 |
gcggatggagttggaggaggaagtgaggagggagcttgcaatggagggggcgtttggaaccatgcagaggcctctcaattctctatggtcaaattctaca |
54056597 |
T |
 |
| Q |
101 |
ccga |
104 |
Q |
| |
|
|||| |
|
|
| T |
54056598 |
ccga |
54056601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 169 - 230
Target Start/End: Original strand, 54056600 - 54056661
Alignment:
| Q |
169 |
gaccagtggcaaggacaaagttattctattggtcagtttcgtaactttttctattctcttct |
230 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||||||||||| | || ||||||| ||| |||| |
|
|
| T |
54056600 |
gacctgtgacaaggacaaagttattctattggtcagtttcattacgttttctactcttttct |
54056661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000003; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 178 - 230
Target Start/End: Complemental strand, 15039809 - 15039756
Alignment:
| Q |
178 |
caaggacaaagttattctattggtca-gtttcgtaactttttctattctcttct |
230 |
Q |
| |
|
|||||||||| ||||||||||||| | ||||| ||||||||||||||||||||| |
|
|
| T |
15039809 |
caaggacaaaattattctattggtaaagtttcataactttttctattctcttct |
15039756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 11 - 68
Target Start/End: Complemental strand, 15039952 - 15039895
Alignment:
| Q |
11 |
ttggaggatgaagtgaggagggagcttgcaatggagggggcgtttggaactatgcaga |
68 |
Q |
| |
|
|||||||| || ||| |||||||||||||||||||| || |||||||||| ||||||| |
|
|
| T |
15039952 |
ttggaggaggaggtgtggagggagcttgcaatggagaggacgtttggaaccatgcaga |
15039895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University