View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2825_low_8 (Length: 248)
Name: NF2825_low_8
Description: NF2825
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2825_low_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 17 - 239
Target Start/End: Complemental strand, 46069543 - 46069320
Alignment:
| Q |
17 |
actccttgtttggaaatgagaaaaattcatcgaatccattaatttatggtaagatgattttgtaaggatgtaaaaggagagaatgaaatttggaggttga |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
46069543 |
actccttgtttggaaatgagaaaaattcatcgaatccattaatttatggtaagatgattttgtaaggatgtaaaaggagagaatgaaatttggagattga |
46069444 |
T |
|
| Q |
117 |
agtattaatgaatgagatgtaataagtgggaatttaagattcagataataatttttacaaatta-tagagtatttcgggaaagaagattaatcctaattc |
215 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||| ||||||||||| |
|
|
| T |
46069443 |
agtattaatcaatgagatgtaataagtgggaatttaagattcagataataatttttacaaattattagagtatttcggggaagaagatcaatcctaattc |
46069344 |
T |
|
| Q |
216 |
aaaattttgggaaagatgatgatg |
239 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
46069343 |
aaaattttgggaaagatgatgatg |
46069320 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University