View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2826-Insertion-10 (Length: 174)
Name: NF2826-Insertion-10
Description: NF2826
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2826-Insertion-10 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 135; Significance: 1e-70; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 135; E-Value: 1e-70
Query Start/End: Original strand, 8 - 174
Target Start/End: Original strand, 44244163 - 44244329
Alignment:
| Q |
8 |
gcattaccggtcaattttatgaatcttattcttaggtggaatattaagttggtaagtaacttgtcctatatatgatcttattgatttttaacagaccata |
107 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||| |||||||| |
|
|
| T |
44244163 |
gcattaccggtcaattttatggatcttattcttaggtggaatattaagttggtaaataacttgtcctgtatatgatcttattgatttttaatagaccata |
44244262 |
T |
 |
| Q |
108 |
ttacaatctaggattgagtttctcattcatatttttgattaatgacttctgtctgaatggctgcaat |
174 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| ||||||||||| ||||| ||||||||||| |
|
|
| T |
44244263 |
ttacaatctaggattgagtttctcattcatctttttggttaatgacttcagtctgtatggctgcaat |
44244329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 109 - 144
Target Start/End: Original strand, 12541378 - 12541413
Alignment:
| Q |
109 |
tacaatctaggattgagtttctcattcatatttttg |
144 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| |
|
|
| T |
12541378 |
tacaatctaggattgagtttctcattcatgtttttg |
12541413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University