View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2826-Insertion-9 (Length: 327)
Name: NF2826-Insertion-9
Description: NF2826
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2826-Insertion-9 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
| [»] scaffold0041 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 8 - 327
Target Start/End: Original strand, 41143045 - 41143352
Alignment:
| Q |
8 |
gttccaccatatgcccaccttggccttgatgattcacataattataatcatacccttgttggtgttggttcacataattgtaattatacccttcttgatt |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
41143045 |
gttccaccatatgcccaccttggccttgatgattcacataattataatcatacccttgttggtgttggttcgcataattgtaattatacccttcttgatt |
41143144 |
T |
|
| Q |
108 |
cacataattataattgtgcacttgttgattcgaataccctggctgaacctgcatcgcgtagttactactactactnnnnnnnnnnnnnnnnnnnntactt |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || || |
|
|
| T |
41143145 |
cacataattataattgtgcacttgttgattcgaataccctggctgaacctgcatcgcgtagttactactactact------------accaccactattt |
41143232 |
T |
|
| Q |
208 |
tgacccggttcatatccgtcataccaatacataggagtttgatgcccatatccgtaaccatgatgctccattttattaacctctaccttagttccgactt |
307 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41143233 |
tgacccggttcatatccgtcataccaatacataggagtttgatgcccatatccataaccatgatgctccattttattaacctctaccttagttccgactt |
41143332 |
T |
|
| Q |
308 |
cctttgctttttctccctct |
327 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
41143333 |
cctttgctttttctccctct |
41143352 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0041 (Bit Score: 116; Significance: 5e-59; HSPs: 1)
Name: scaffold0041
Description:
Target: scaffold0041; HSP #1
Raw Score: 116; E-Value: 5e-59
Query Start/End: Original strand, 208 - 327
Target Start/End: Complemental strand, 112078 - 111959
Alignment:
| Q |
208 |
tgacccggttcatatccgtcataccaatacataggagtttgatgcccatatccgtaaccatgatgctccattttattaacctctaccttagttccgactt |
307 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
112078 |
tgacccggttcatatccgtcataccaatacataggagtttgatgcccatatccataaccatgatgctccattttattaacctctaccttagttccgactt |
111979 |
T |
|
| Q |
308 |
cctttgctttttctccctct |
327 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
111978 |
cctttgctttttctccctct |
111959 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University