View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2826_high_23 (Length: 290)
Name: NF2826_high_23
Description: NF2826
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2826_high_23 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 158; Significance: 4e-84; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 1 - 158
Target Start/End: Original strand, 44552895 - 44553052
Alignment:
| Q |
1 |
cctcgacaactcctgcactatctatgacccaccaacaaactcatttttgtttatattcttttgggccctttttgcagctgctccttttcactagctacta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44552895 |
cctcgacaactcctgcactatctatgacccaccaacaaactcatttttgtttatattcttttgggccctttttgcagctgctccttttcactagctacta |
44552994 |
T |
 |
| Q |
101 |
ctatactcaagctgatgcacccactgcaggcttgtttgccactacttcaaagttacca |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44552995 |
ctatactcaagctgatgcacccactgcaggcttgtttgccactacttcaaagttacca |
44553052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 230 - 273
Target Start/End: Original strand, 44553124 - 44553167
Alignment:
| Q |
230 |
ctgtccacggttctgctccatgttatcttctccctgctgaggtg |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44553124 |
ctgtccacggttctgctccatgttatcttctccctgctgaggtg |
44553167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University