View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2826_high_24 (Length: 287)
Name: NF2826_high_24
Description: NF2826
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2826_high_24 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 2 - 273
Target Start/End: Original strand, 1154915 - 1155164
Alignment:
| Q |
2 |
cagtaaatatcaaatcatcaacatacaaacttacatttagaatcttacctccagcgcctgtcatgagaaacaaagtgtgttcacgcgagcatgtttcaaa |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1154915 |
cagtaaatatcaaatcatcaacatacaaacttacaattagaatcttacctccagcacctgtcatgagaaacaaagtgtgttcacgcgagcatgtttcaaa |
1155014 |
T |
 |
| Q |
102 |
gccttcttttagaaaatacgattctatacgaatgtaccatgctcgtggagcttgtttcagtccatacttggagcttgttcagtccatgaagtgtattctt |
201 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
1155015 |
gccttctttcagaaaatacgattctatacgaatgtaccatgctcgtggagcttgtttcagtcca----------------------tgaagtgtattctt |
1155092 |
T |
 |
| Q |
202 |
caacttatacaccttatgcccattgccgttaatttcatatccgcaaggctgttccacaaacacttattcatt |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1155093 |
caacttatacaccttatgcccattgccgttaatttcatatccgcaaggctgttccacaaacacttattcatt |
1155164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University