View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2826_high_26 (Length: 273)
Name: NF2826_high_26
Description: NF2826
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2826_high_26 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 1 - 196
Target Start/End: Original strand, 44734330 - 44734521
Alignment:
| Q |
1 |
ttgtttgtgttcaaggtactgttgttgtcgcgggaatgccactgctatttaaagccatcacaaacgacttaaggacccttttcacacnnnnnnnnnnnng |
100 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| | |
|
|
| T |
44734330 |
ttgtttgtgttcaaggttctgttgttgtcgcgggaatgccactgctatttaaagtcatcacaaacgacttaaggacccttttcacacaaaaacaaaaaag |
44734429 |
T |
 |
| Q |
101 |
gactaatgagtaatgaatgaccccacctagcatattctttctttctatccttttaacacatttacattgagagggatctattttattcctaaatgg |
196 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44734430 |
gactaatgagtaatg----accccacctagcatattctttctttctatccttttaacacatttacattgagagggatctattttattcctaaatgg |
44734521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University