View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2826_high_35 (Length: 242)
Name: NF2826_high_35
Description: NF2826
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2826_high_35 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 44734310 - 44734087
Alignment:
| Q |
1 |
caaattaaccttgttgtgt--cagttgaattttcaagtgttttaactaacttagtagtttgatttgatcatcaattagccaaaacgggtcttccactgtg |
98 |
Q |
| |
|
||||||||||||||||||| ||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
44734310 |
caaattaaccttgttgtgtgtcagttgagttttcaagtgttttaactaacttagt---ttgatttgatcatcaattagccaaaacgggtcttccactttg |
44734214 |
T |
 |
| Q |
99 |
gatgcttggtttgggtgcggacctcttgtgggccgacatgaatcgtctccttgcctttctcttccaccagggggtgttggatgagcaatttttgcagctt |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44734213 |
gatgcttggtttgggtgcggacctcttgtgggccgacatgaatcgtctccttgcctttctcttccaccagggggtgttggatgagcaatttttgcagctt |
44734114 |
T |
 |
| Q |
199 |
caacagcttcaagatcatacctcccct |
225 |
Q |
| |
|
||||||||||||||||| ||||||||| |
|
|
| T |
44734113 |
caacagcttcaagatcacacctcccct |
44734087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 75 - 149
Target Start/End: Original strand, 2259650 - 2259724
Alignment:
| Q |
75 |
agccaaaacgggtcttccactgtggatgcttggtttgggtgcggacctcttgtgggccgacatgaatcgtctcct |
149 |
Q |
| |
|
||||||||||||||| || || ||| ||||||| |||||| ||||||||||||||||||||||||| || ||||| |
|
|
| T |
2259650 |
agccaaaacgggtctccctctttggttgcttggattgggtccggacctcttgtgggccgacatgaaccgcctcct |
2259724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University