View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2826_low_34 (Length: 262)
Name: NF2826_low_34
Description: NF2826
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2826_low_34 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 12 - 247
Target Start/End: Original strand, 29661963 - 29662198
Alignment:
| Q |
12 |
acagagttcttgccaccaccagtagtgcctttaccactagtagtacctctactagtagtgcctctactattattcttctcttcaaccttcttgagaatag |
111 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29661963 |
acagagttcttgccaccactagtagtgcctttaccactagtagtacctctactagtagtgcctctactattattcttctcttcaaccttcttgagaatag |
29662062 |
T |
 |
| Q |
112 |
gatcagtttcatagaactgatcttcttttgttaaaccaccaacaatccaatcccaaaaacctttctcttgcttgctactgccaccacctgtagtaccctt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29662063 |
gatcagtttcatagaactgatcttcttttgttaaaccaccaacaatccaatcccaaaaacctttctcttgcttgctactgccaccacctgtagtaccctt |
29662162 |
T |
 |
| Q |
212 |
tgcacctgtagctgcaaagactcttcctgttgttgg |
247 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| |
|
|
| T |
29662163 |
tgcacctgtagctgcaaagactcttcccgttgttgg |
29662198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University