View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2826_low_35 (Length: 253)
Name: NF2826_low_35
Description: NF2826
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2826_low_35 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 13 - 253
Target Start/End: Original strand, 18639985 - 18640225
Alignment:
| Q |
13 |
aatatcaataaagaaaatcatgagagtttcactaaactatacctaaagctatcaagtacttacttgcagtccatcgaattttggaacacggagatcttga |
112 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18639985 |
aatatcaataaaggaaatcatgagagtttcactaaactatacctaaagctatcaagtacttacttgcagtccatcgaattttggaacacggagatcttga |
18640084 |
T |
 |
| Q |
113 |
ccacctaaaaggaaaagtgttggtgcttttacctgcagaattcatcaaaacacataatgttagaaatcaactgtatgcagtaggatatgtcataatcatt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18640085 |
ccacctaaaaggaaaagtgttggtgcttttacctgcagaattcatcaaaacacataatgttagaaatcaactgtatgcagtaggatatgtcataatcatt |
18640184 |
T |
 |
| Q |
213 |
tagccaatgctcgggattaattcaggatgcataaccatgaa |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18640185 |
tagccaatgctcgggattaattcaggatgcataaccatgaa |
18640225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University