View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2826_low_41 (Length: 247)
Name: NF2826_low_41
Description: NF2826
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2826_low_41 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 135; Significance: 2e-70; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 11 - 169
Target Start/End: Original strand, 10231729 - 10231887
Alignment:
| Q |
11 |
gatactattacaaacaagtatactgtataaatccatgtggttcaaatgaaagcatacacctaactcatgatacacgagggaccgcattcatataattgag |
110 |
Q |
| |
|
||||||||||||||||||||||||||||| || |||||||||||||||||||| ||||||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
10231729 |
gatactattacaaacaagtatactgtatacattcatgtggttcaaatgaaagcgtacacctaaatcatgatacatgagggaccgcattcatataattgag |
10231828 |
T |
|
| Q |
111 |
ttcaaacttgatagactaaatttgcacaatcctgagtaatttaataaagtgaaattaag |
169 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10231829 |
ttcaaacttgatatactaaatttgcacaatcctgagtaatttaataaagtgaaattaag |
10231887 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 86 - 153
Target Start/End: Original strand, 10241205 - 10241272
Alignment:
| Q |
86 |
gagggaccgcattcatataattgagttcaaacttgatagactaaatttgcacaatcctgagtaattta |
153 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||| ||||| |||| |||| |||||| |
|
|
| T |
10241205 |
gagggaccacattcatataattgagttcaaacttgatagactaattttgcgcaattatgagcaattta |
10241272 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 197 - 229
Target Start/End: Original strand, 10231908 - 10231940
Alignment:
| Q |
197 |
aagtttcattgttgagaattgagatatactaga |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
10231908 |
aagtttcattgttgagaattgagatatactaga |
10231940 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University