View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2826_low_44 (Length: 241)
Name: NF2826_low_44
Description: NF2826
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2826_low_44 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 100 - 222
Target Start/End: Original strand, 13082727 - 13082849
Alignment:
| Q |
100 |
ctgcaaaacattctaaaaagatacatagtcaagatgcctgtcaaggaaatggtggaacaaagggtttagccaccgtcaaagaacttggaaatatgaagat |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13082727 |
ctgcaaaacattctaaaaagatacatagtcaagatgcctgtcaaggaaatggtggaacaaagggtttagccaccgtcaaagaacttggaaatatgaagat |
13082826 |
T |
 |
| Q |
200 |
gcactcttatcatgggaaggtag |
222 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
13082827 |
gcactcttatcatgggaaggtag |
13082849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 15 - 47
Target Start/End: Complemental strand, 28956467 - 28956435
Alignment:
| Q |
15 |
cgggtatccatcgggcctggatccaattgtcat |
47 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |
|
|
| T |
28956467 |
cgggtgtccatcgggcctggatccaattgtcat |
28956435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University