View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2826_low_46 (Length: 238)
Name: NF2826_low_46
Description: NF2826
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2826_low_46 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 38582708 - 38582945
Alignment:
| Q |
1 |
ataatcattattctgcatttcatcatcactcatatcatcttggattccctcattgtcatcctcacaagggtccagcacactcttcacctataaaatggaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38582708 |
ataatcattattctgcatttcatcatcactcatatcatcttggattccctcattgtcatcctcacaagggtccagcacactcttcacctataaaatggaa |
38582807 |
T |
|
| Q |
101 |
gaagatgtcgtcagcaaaaacattagaaaaatatttcaaacttggctttgagcaggatatccttcaattaccttcagagctaacacaaaatgcttgctgt |
200 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38582808 |
gaagatatcgtcagcaaaaacattagaaaaatatttaaaacttggctttgagcaggatatccttcaattaccttcagagctaacacaaaatgcttgctgt |
38582907 |
T |
|
| Q |
201 |
ttacatccccaacctccattttcagtggatttttcacc |
238 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
38582908 |
ttacattcccaacctccattttcagtggatttttcacc |
38582945 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University