View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2826_low_47 (Length: 233)
Name: NF2826_low_47
Description: NF2826
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2826_low_47 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 97; Significance: 8e-48; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 119 - 227
Target Start/End: Complemental strand, 54056330 - 54056222
Alignment:
| Q |
119 |
ggattttcagattgaattacttggaagagatcgatcagggatatatgtgacggtgggaagagaaggctgcatggttgatggattgatgttgtcgatagca |
218 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54056330 |
ggattttcctattgaattacttggaagagatcgatcagggagatatgtgacggtgggaagagaaggctgcatggttgatggattgatgttgtcgatagca |
54056231 |
T |
|
| Q |
219 |
cgaaatttg |
227 |
Q |
| |
|
||||||||| |
|
|
| T |
54056230 |
cgaaatttg |
54056222 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 119 - 227
Target Start/End: Complemental strand, 54456645 - 54456537
Alignment:
| Q |
119 |
ggattttcagattgaattacttggaagagatcgatcagggatatatgtgacggtgggaagagaaggctgcatggttgatggattgatgttgtcgatagca |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
54456645 |
ggattttcagattgaattacttggaagagatcggtcagggagatatgtgacggtgggatgagaaggctgcatggttgatggattgatgttatcgatagca |
54456546 |
T |
|
| Q |
219 |
cgaaatttg |
227 |
Q |
| |
|
|| |||||| |
|
|
| T |
54456545 |
cggaatttg |
54456537 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 38
Target Start/End: Complemental strand, 54456753 - 54456716
Alignment:
| Q |
1 |
caatggtgctcggaagccagcaaaaccaccgtccactg |
38 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54456753 |
caatggtgctcggaagccagcaaaaccaccgtccactg |
54456716 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 190 - 227
Target Start/End: Original strand, 52322202 - 52322239
Alignment:
| Q |
190 |
tggttgatggattgatgttgtcgatagcacgaaatttg |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
52322202 |
tggttgatggattgatgttgtcgatagcacgatatttg |
52322239 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University