View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2826_low_50 (Length: 208)
Name: NF2826_low_50
Description: NF2826
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2826_low_50 |
 |  |
|
| [»] scaffold0274 (1 HSPs) |
 |  |  |
|
| [»] scaffold0271 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 38 - 192
Target Start/End: Original strand, 41418667 - 41418821
Alignment:
| Q |
38 |
tatgaattgacaccaaaatccatttttgggtttttcagttttgttaagaatcacagtttcaacttacctttatcgaaaaactacactttgttagagtgat |
137 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
41418667 |
tatgaattgacaccaaaatccattttatggttttttagttttgttaagaatcacagtttcaacttacctttaccgaaaaactgcactttgttagagtgat |
41418766 |
T |
 |
| Q |
138 |
tgaatgcgtgatgacggtagatcactggattttaaacacacacgtattctctttg |
192 |
Q |
| |
|
|||||||| | || ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41418767 |
tgaatgcgcggtggcggtagatcactggattttaaacacacacgtattctctttg |
41418821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0274 (Bit Score: 119; Significance: 5e-61; HSPs: 1)
Name: scaffold0274
Description:
Target: scaffold0274; HSP #1
Raw Score: 119; E-Value: 5e-61
Query Start/End: Original strand, 38 - 192
Target Start/End: Original strand, 6419 - 6573
Alignment:
| Q |
38 |
tatgaattgacaccaaaatccatttttgggtttttcagttttgttaagaatcacagtttcaacttacctttatcgaaaaactacactttgttagagtgat |
137 |
Q |
| |
|
||||||| ||||||||||||||||||||| ||| ||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
6419 |
tatgaatcgacaccaaaatccatttttggatttctcagttttgttaagaatcatagtttcaacttacctttaccgaaaaactacactttgttagagtgat |
6518 |
T |
 |
| Q |
138 |
tgaatgcgtgatgacggtagatcactggattttaaacacacacgtattctctttg |
192 |
Q |
| |
|
|||||||| | || |||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
6519 |
tgaatgcgcggtggcggtagatcacttgattttaaacacacacgtattctctttg |
6573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0271 (Bit Score: 119; Significance: 5e-61; HSPs: 1)
Name: scaffold0271
Description:
Target: scaffold0271; HSP #1
Raw Score: 119; E-Value: 5e-61
Query Start/End: Original strand, 38 - 192
Target Start/End: Complemental strand, 2872 - 2718
Alignment:
| Q |
38 |
tatgaattgacaccaaaatccatttttgggtttttcagttttgttaagaatcacagtttcaacttacctttatcgaaaaactacactttgttagagtgat |
137 |
Q |
| |
|
||||||| ||||||||||||||||||||| ||| ||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
2872 |
tatgaatcgacaccaaaatccatttttggatttctcagttttgttaagaatcatagtttcaacttacctttaccgaaaaactacactttgttagagtgat |
2773 |
T |
 |
| Q |
138 |
tgaatgcgtgatgacggtagatcactggattttaaacacacacgtattctctttg |
192 |
Q |
| |
|
|||||||| | || |||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
2772 |
tgaatgcgcggtggcggtagatcacttgattttaaacacacacgtattctctttg |
2718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University