View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2827_high_16 (Length: 312)
Name: NF2827_high_16
Description: NF2827
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2827_high_16 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 18 - 303
Target Start/End: Original strand, 47285898 - 47286183
Alignment:
| Q |
18 |
agagtctaggtctagaagccggtgacattacactaaaccgtttatctgatttggtttctgatgaactgaaaattaccggtgttaaaacaggttgacatcc |
117 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||| |
|
|
| T |
47285898 |
agagtctaggtctagaagctggtgacattacactaaatcgtttatctgatttggtttctgatgaacggaaaattaccggtgttaaaacaggttgacgtcc |
47285997 |
T |
|
| Q |
118 |
gttttcccatccagctgtacctgatccagcgccgttaattataataacatcgccgttaggtagaattaacatgtctcccattactcttgccattggcata |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47285998 |
gttttcccatccagctgtacctgatccagcgccgttaattataataacatcgccgttaggtagaattaacatgtctcccattactcttgccattggcata |
47286097 |
T |
|
| Q |
218 |
ttctcaataatccaactaggattcgaatccgttactttgagaaatccacatgttttaagtgctggcatgaagttctttccctttgc |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47286098 |
ttctcaataatccaactaggattcgaatccgttactttgagaaatccacatgttttaagtgctggcatgaagttctttccctttgc |
47286183 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University