View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2827_high_4 (Length: 518)
Name: NF2827_high_4
Description: NF2827
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2827_high_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 495; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 495; E-Value: 0
Query Start/End: Original strand, 1 - 503
Target Start/End: Complemental strand, 45698180 - 45697678
Alignment:
| Q |
1 |
ttccttttctaattgcacaggttgttgctttcttgggagttcttatttataaattctatggagatgaacttagagaaatgtttggttatgaagaacatcc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45698180 |
ttccttttctaattgcacaggttgttgctttcttgggagttcttatttataaattctatggagatgaacttagagaaatgtttggttatgaagaacatcc |
45698081 |
T |
 |
| Q |
101 |
atacggattttacacaatggccggtattcccatttattcaccactctcaaattcatggccaatgtttgcagcttttccactcatttgtgactttttcagt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45698080 |
atacggattttacacaatggccggtattcccatttattcaccactctcaaattcatggccaatgtttgcagcttttccactcatttgtgactttttcagt |
45697981 |
T |
 |
| Q |
201 |
tagatagtaaatttaacacttaagatgtgtaacaactgactagtgtgctatcttaacctaccaacttattaaatgcaatggaaacttgataattttgctc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45697980 |
tagatagtaaatttaacacttaagatgtgtaacaactgactagtgtgctatcttaacctaccaacttattaaatgcaatggaaacttgataattttgctc |
45697881 |
T |
 |
| Q |
301 |
tgttttgcagttcttgccattattttggtgggtttgctctatggcttctttatagcaataatatgtgggcaaagaatcaatgaacgccactaccatgttc |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45697880 |
tgttttgcagttcttgccattattttggtgggtttgctctatggcttctttatagcaataatatgtgggcaaagaatcaatgaacgccactaccatgttc |
45697781 |
T |
 |
| Q |
401 |
ttgccaaacaagaattgacaaaggtctgctatgtaatagtaataaattccttcaaatatgttactcaaaactagtaatatgcttgccgcgaaacacgtct |
500 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||| |
|
|
| T |
45697780 |
ttgccaaacaagaattgacaaaggtctgctatgtaatagtaataaattccttcaaatatgttactcaaaactagtaatatgcttgctgcaaaacacgtct |
45697681 |
T |
 |
| Q |
501 |
ctg |
503 |
Q |
| |
|
||| |
|
|
| T |
45697680 |
ctg |
45697678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University