View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2827_high_7 (Length: 409)
Name: NF2827_high_7
Description: NF2827
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2827_high_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 363; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 363; E-Value: 0
Query Start/End: Original strand, 1 - 391
Target Start/End: Complemental strand, 43339800 - 43339410
Alignment:
| Q |
1 |
gtcggtgaacatctcttattacttcccttctccgcaattccactctagctggcagcctgctccaaatctgcgaagctgctgccacaataatcttcatcat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43339800 |
gtcggtgaacatctcttattacttcccttctccgcaattccactctagttggcagcctgctccaaatctgcgaagctgctgccacaataatcttcatcat |
43339701 |
T |
 |
| Q |
101 |
attcagcatcacggaacaaatttgacagcaccaaatagaannnnnnnncaccaagaaccctgctccttcgtcgggcagccagcagaaggtatcagaaaca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43339700 |
attcagcatcacggaacaaatttgacagcaccaaatagaattttttttcaccaagaaccctgctccttcgtcgggcagccagcagaaggtatcagaaaca |
43339601 |
T |
 |
| Q |
201 |
gatggtcgcggctgcacctgcagaatttcctactgcaaaacagatggtccggttgcaaatttttggaccaattccatctccaaatccacatattatctca |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43339600 |
gatggtcgcggctgcacctgcagaatttcctactgcaaaacagatggtccggttgcaaatttttggaccaattccatctccaaatccacatattatctca |
43339501 |
T |
 |
| Q |
301 |
ccaacatcccatgtcggacaccttaacatctctgttagaaaccgcactgaataaatgagggaatcacacacagaatggttgttctctgatc |
391 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43339500 |
ccaacatcccatgtcggacaccttaacatctctgttagaaaccgcactgaataaatgagggaatcacacacagaatggttgttctctgatc |
43339410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University