View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2827_high_8 (Length: 405)
Name: NF2827_high_8
Description: NF2827
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2827_high_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 306; Significance: 1e-172; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 16 - 392
Target Start/End: Complemental strand, 47501206 - 47500826
Alignment:
| Q |
16 |
tcccctttgttcatccactctgggcttgcttcatcaggcaacaggtttgaaggtagctccatactcaaatatgttaccttgattgattaagtttaagaga |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
47501206 |
tcccctttgttcatccactctgggcttgcttcatcaggcaacaggtttgaaggtagctccatactcaaatatgttaccttaattgattaagtttaagaga |
47501107 |
T |
 |
| Q |
116 |
gattcatgcactatataaataaatatgtgatcgattatgtttttacttggtagaggacatgcaatttgtcgtttctatttatttatt----tattgtatg |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
47501106 |
gattcatgcactatataaataaatatgtgatcgattatgtttttacttggtagaggacatgcaatttgtcgtttctatttatttatttatttattgtatg |
47501007 |
T |
 |
| Q |
212 |
ggttctaaaggccggctaattcgttggcacttggct---gcaacagttaagtacgttttccattnnnnnnnggttaagtacgaatttgcttcattcatga |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
47501006 |
ggttctaaaggccggctaattcgttggcacttggctgcagcaacagttaagtacgttttccatcaaaaaaaggttaagtacgaatttgcttcattcatga |
47500907 |
T |
 |
| Q |
309 |
tgctcacaacttcggattaatcatttctacctaaaaacttcagtactacttccaagtttttgggttcagtaatatttgtacttc |
392 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
47500906 |
tgctcacaacttcggatta---atttctacctaaaaacttcagtactgcttccaagtttttgggttcagtaatatttgtacttc |
47500826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University