View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2827_low_21 (Length: 288)
Name: NF2827_low_21
Description: NF2827
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2827_low_21 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 244; Significance: 1e-135; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 17 - 272
Target Start/End: Complemental strand, 27561194 - 27560939
Alignment:
| Q |
17 |
tgtgcagctatgctggtggtgaagatttttcaccataggggctggcacagtctttgattggaaaatgattccaatttggtcattgatgtcttcacaaatg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27561194 |
tgtgcagctatgctggtggtgaagatttttcaccataggggctggcacagtctttgattggaaaatgattccaatttggtcattgatgtcttcacaaatg |
27561095 |
T |
 |
| Q |
117 |
ttcacgctgtctcgttgtcaattagaagtcggttgtaaaattgtctttttctttgtaaaaatatcctttgtagttttttcacacatttatagggaaggaa |
216 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27561094 |
ttcacgctgtctcgttgtccattagaagtcggttgtaaaattgtctttttatttgtaaagatatcctttgtagttttttcacacatttatagggaaggaa |
27560995 |
T |
 |
| Q |
217 |
ataactacgcttgttatgctattggccatgtttggtgggactttgtccttgatttt |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27560994 |
ataactacgcttgttatgctattggccatgtttggtgggactttgtccttgatttt |
27560939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 17 - 66
Target Start/End: Complemental strand, 27561294 - 27561245
Alignment:
| Q |
17 |
tgtgcagctatgctggtggtgaagatttttcaccataggggctggcacag |
66 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
27561294 |
tgtgcagctttgctggtgatgaagatttttcaccataggggctggcacag |
27561245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University