View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2827_low_21 (Length: 288)

Name: NF2827_low_21
Description: NF2827
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2827_low_21
NF2827_low_21
[»] chr5 (2 HSPs)
chr5 (17-272)||(27560939-27561194)
chr5 (17-66)||(27561245-27561294)


Alignment Details
Target: chr5 (Bit Score: 244; Significance: 1e-135; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 17 - 272
Target Start/End: Complemental strand, 27561194 - 27560939
Alignment:
17 tgtgcagctatgctggtggtgaagatttttcaccataggggctggcacagtctttgattggaaaatgattccaatttggtcattgatgtcttcacaaatg 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27561194 tgtgcagctatgctggtggtgaagatttttcaccataggggctggcacagtctttgattggaaaatgattccaatttggtcattgatgtcttcacaaatg 27561095  T
117 ttcacgctgtctcgttgtcaattagaagtcggttgtaaaattgtctttttctttgtaaaaatatcctttgtagttttttcacacatttatagggaaggaa 216  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||    
27561094 ttcacgctgtctcgttgtccattagaagtcggttgtaaaattgtctttttatttgtaaagatatcctttgtagttttttcacacatttatagggaaggaa 27560995  T
217 ataactacgcttgttatgctattggccatgtttggtgggactttgtccttgatttt 272  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27560994 ataactacgcttgttatgctattggccatgtttggtgggactttgtccttgatttt 27560939  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 17 - 66
Target Start/End: Complemental strand, 27561294 - 27561245
Alignment:
17 tgtgcagctatgctggtggtgaagatttttcaccataggggctggcacag 66  Q
    ||||||||| |||||||| |||||||||||||||||||||||||||||||    
27561294 tgtgcagctttgctggtgatgaagatttttcaccataggggctggcacag 27561245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University