View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2827_low_24 (Length: 238)
Name: NF2827_low_24
Description: NF2827
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2827_low_24 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 18 - 143
Target Start/End: Complemental strand, 25463360 - 25463235
Alignment:
| Q |
18 |
ctgaatgtccagaaaatttctgtgtacctcctctgattacgaagtgtgttaattacacatgtatatgtgatgatcctgcatatggagaaccgatatatga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25463360 |
ctgaatgtccagaaaatttctgtgtacctcctctgattacgaagtgtgttaattacacatgtatatgtgatgatcctgcatatggagaaccgatatatga |
25463261 |
T |
|
| Q |
118 |
tttcgtctctgtgaggacagagaaac |
143 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
25463260 |
tttcgtctctgtgaggacagagaaac |
25463235 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 45; Significance: 9e-17; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 18 - 118
Target Start/End: Complemental strand, 24108254 - 24108154
Alignment:
| Q |
18 |
ctgaatgtccagaaaatttctgtgtacctcctctgattacgaagtgtgttaattacacatgtatatgtgatgatcctgcatatggagaaccgatatatga |
117 |
Q |
| |
|
|||| ||||||||||| || ||||| |||||| ||| || ||||| ||||||||||||||||||||||||||||| ||||||| |||||| |||||| |
|
|
| T |
24108254 |
ctgattgtccagaaaacttttgtgtgcctcctttgactatccagtgtattaattacacatgtatatgtgatgatcctccatatggtgaaccggaatatga |
24108155 |
T |
|
| Q |
118 |
t |
118 |
Q |
| |
|
| |
|
|
| T |
24108154 |
t |
24108154 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University