View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2828_high_6 (Length: 320)
Name: NF2828_high_6
Description: NF2828
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2828_high_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 6 - 295
Target Start/End: Original strand, 1256045 - 1256334
Alignment:
| Q |
6 |
tgataagaatataatggggacaagaaatggtgaaggagagatgttgaagcttttgaggattggaatgtattgttgtgagaggagtgttgagagaagatgg |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
1256045 |
tgataagaatataatggggacaagaaatggtgaaggtgagatgttgaagcttttgaggattggaatgtactgttgtgaatggagtgttgagagaagatgg |
1256144 |
T |
 |
| Q |
106 |
gattggaaagaagctttggataagattgaagagcttaaggagaatgatggtgaagatgaatctttttcttatgttagtgaaggtgatttgtattcaagag |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1256145 |
gattggaaagaagctttggataagattgaagagcttaaggagaatgatggtgaagatgaatctttttcttatgttagtgaaggtgatttgtattcaagag |
1256244 |
T |
 |
| Q |
206 |
gtgcaactgaggatgaattttctttttctgtcactgattcacaggctgataagtttggaaatgttacaggctagggtttgtttaattaac |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1256245 |
gtgcaactgaggatgaattttctttttctgttactgattcacaggctgataagtttggaaatgttacaggctagggtttgtttaattaac |
1256334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 37 - 83
Target Start/End: Original strand, 36126150 - 36126196
Alignment:
| Q |
37 |
gaaggagagatgttgaagcttttgaggattggaatgtattgttgtga |
83 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
36126150 |
gaaggtgagatgttgaagctgttgaggattggaatgagttgttgtga |
36126196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University