View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2828_low_13 (Length: 249)
Name: NF2828_low_13
Description: NF2828
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2828_low_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 176; Significance: 6e-95; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 1 - 180
Target Start/End: Original strand, 43199217 - 43199396
Alignment:
| Q |
1 |
tgcttatacgactaagatttcttcttcccgccaattctgggtactagctgaaatcctcacgccaaggaaattgatatcactcactctttagaaatttaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43199217 |
tgcttatacgactaagatttcttcttcccgccaattctgggtactagctgaaatcctcacgccaaggaaattgatatcactcactctttagaaatttaaa |
43199316 |
T |
 |
| Q |
101 |
tactagttttttcaatggagtatgaccatccaccaactacattacaaaatatctacgtcttaaatgtgcttataagcctc |
180 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43199317 |
tactagttttctcaatggagtatgaccatccaccaactacattacaaaatatctacgtcttaaatgtgcttataagcctc |
43199396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 201 - 242
Target Start/End: Original strand, 43199415 - 43199456
Alignment:
| Q |
201 |
aatgttttcaatttaattaaattgcatgcatttgcctatgct |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
43199415 |
aatgttttcaatttaattaaattgcatgcatttgcctttgct |
43199456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University