View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2828_low_14 (Length: 234)
Name: NF2828_low_14
Description: NF2828
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2828_low_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 43199170 - 43198947
Alignment:
| Q |
1 |
tcttctatttgtttta---gacctttctttttctatatcatcgatgatgcaccatacaccatactcgtgcaaatacatattattgcttttaaaatctctg |
97 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
43199170 |
tcttctatttgttttattagacctttctttttctatatcatcgatgatgcaccatacaccatactcgtgcaaatacatattattgcttttgaaatctctg |
43199071 |
T |
 |
| Q |
98 |
tttaattagaatacttaactatttaaatatagatgtgacatgtattggtccgatgtcatgattgcttaaactcgtggcatcctcatggtgttgacataaa |
197 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43199070 |
tttaattagaatacttaactatttacatatagatgtgacatgtattggtccgatgtcatgattgcttaaactcgtggcatcctcatggtgttgacataaa |
43198971 |
T |
 |
| Q |
198 |
ccaatcaatattctttgtatttgg |
221 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
43198970 |
ccaatcaatattctttgtatttgg |
43198947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University