View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2828_low_15 (Length: 218)
Name: NF2828_low_15
Description: NF2828
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2828_low_15 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 218
Target Start/End: Complemental strand, 46279194 - 46278977
Alignment:
| Q |
1 |
caggctcagaataaaatgcattatgcattgctgtgttatttctttgctttcctttttggaatgttatgtggtgaggtatcttcagaattttggaaacaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46279194 |
caggctcagaataaaatgcattatgcattgctgtgttatttctttgctttcctttttggaatgttatgtggtgaggtatcttcagaattttggaaacaat |
46279095 |
T |
 |
| Q |
101 |
atttcataaatattgttgtgtgtgtatgtcatctctatttaaagtgttgccactttcttgtttgtttctgttctgagttctgaccttgaaattggtacaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46279094 |
atttcataaatattgttgtgtgtgtatgtcatctctatttaaagtgttgccactttcttgtttgtttctgttctgagttctgaccttgaaattggtacaa |
46278995 |
T |
 |
| Q |
201 |
gtttacaatttatatatg |
218 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
46278994 |
gtttacaatttatatatg |
46278977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University