View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2829_high_3 (Length: 292)
Name: NF2829_high_3
Description: NF2829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2829_high_3 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 143; Significance: 4e-75; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 143; E-Value: 4e-75
Query Start/End: Original strand, 1 - 159
Target Start/End: Complemental strand, 2708689 - 2708531
Alignment:
| Q |
1 |
atcttgccgttcaagatatgcctcctatgaggttgggtttgtctcgtagcctatcaatatacaagttgaagcatagtgcagacaaggtatatattctgtt |
100 |
Q |
| |
|
|||| |||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2708689 |
atctcgccgttcaagatatgcctccgatgaggttgggtttgtctggtagcctatcaatatacaagttgaagcatagtgcagacaaggtatatattctgtt |
2708590 |
T |
|
| Q |
101 |
gattgtgtgaacagacaatagttaatgtttagcactaatgcaaatgtttgtatattgtt |
159 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
2708589 |
gattgtgtgaacagacaatagttaatgttaagcactaatgcaaatgtttgtatattgtt |
2708531 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 9 - 88
Target Start/End: Complemental strand, 2702742 - 2702663
Alignment:
| Q |
9 |
gttcaagatatgcctcctatgaggttgggtttgtctcgtagcctatcaatatacaagttgaagcatagtgcagacaaggt |
88 |
Q |
| |
|
|||||||| ||| |||| ||||| ||||||||||||| ||||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
2702742 |
gttcaagacatggctccgatgagcttgggtttgtctcatagcctatcaagatacaagttgaagttcagtgcagacaaggt |
2702663 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University