View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2830_low_10 (Length: 251)
Name: NF2830_low_10
Description: NF2830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2830_low_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 243
Target Start/End: Original strand, 24615797 - 24616039
Alignment:
| Q |
1 |
tgtgtttagcctagcggctacctagacgcagttgttcgtttttccaaactctataattagcagcttcagcaaatcacgaccaaatgtgttttgggacaca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24615797 |
tgtgtttagcctagcggctacctagacgcagttgttcgtttttccaaactctacaattagcagcttcagcaaatcacgaccaaatgtgttttgggacacg |
24615896 |
T |
 |
| Q |
101 |
agaatagccaaaggtttttactttttagacttaatgctcgaaggatatgttaagtaccaaatatttggtcatttgacttatatcaattcgacccgatcaa |
200 |
Q |
| |
|
||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
24615897 |
agaataggcaaaggttttcactttttagacttaatgctcgaaggatatgttaagtaccaaatatttggtcatttgacttatatcatttcgacccgatcaa |
24615996 |
T |
 |
| Q |
201 |
caatcaacgctattaaacacgcgtcttctccccaacctttgct |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24615997 |
caatcaacgctattaaacacgcgtcttctccccaacctttgct |
24616039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University