View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2830_low_11 (Length: 243)
Name: NF2830_low_11
Description: NF2830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2830_low_11 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 17 - 211
Target Start/End: Original strand, 29249632 - 29249826
Alignment:
| Q |
17 |
taggatactgtagaacctnnnnnnnctctgccgaaaatcttgactattccttatcattttcaaacctaacaaacatactatcaaaattaatcagagacta |
116 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
29249632 |
taggatactgtagaacctaaaaaaactctgccgaaaatcttgactattccttatcattctcaaacctaacaaacatactatcaaaattaatcacagacta |
29249731 |
T |
|
| Q |
117 |
aaccaagtgattgaattcaagtgattaataatcttcagtaaaggataaatactttgtgataacccgagttctaatcctgacagaaacaatcattg |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29249732 |
aaccaagtgattgaattcaagtgattaataatcttcagtaaaggataaatactttgtgataacccgagttctaatcctgacagaaacaatcattg |
29249826 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University