View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2831_low_13 (Length: 270)
Name: NF2831_low_13
Description: NF2831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2831_low_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 1 - 262
Target Start/End: Complemental strand, 51755924 - 51755663
Alignment:
| Q |
1 |
taactccgtcatcgtcttcaacaacgctgttactaggaacacgcgctggacaagcatcatcatgacgaggttccaacacttccagacctaggtgaggttt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51755924 |
taactccgtcatcgtcttcaacaacgctgttactaggaacacgcgctggacaagcataatcatgacgaggttccaacacttccagacctaggtgaggttt |
51755825 |
T |
|
| Q |
101 |
atcggaggaagtgtcgtgggaaggaggtaacaattcaggtttaggggttgggatcctccagaagattacggcgagccatgtccataaatggttgaagaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
51755824 |
atcggaggaagtgtcgtgggaaggaggtaacaattcaggtttaggggttgggatcctccagaagatgacggcgagccatgtccataaatggttgaagaaa |
51755725 |
T |
|
| Q |
201 |
tcgaagctcaagtagttgaaagctagagtgtcaagtggagaattttctgacatgttcatctc |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
51755724 |
tcgaagctcaagtagttgaaagctagagtgtcaagtggagaattttctaacatgttcatctc |
51755663 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University