View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2831_low_8 (Length: 369)
Name: NF2831_low_8
Description: NF2831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2831_low_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 339; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 339; E-Value: 0
Query Start/End: Original strand, 1 - 355
Target Start/End: Complemental strand, 1493932 - 1493578
Alignment:
| Q |
1 |
agaaggaaaactggaccgaaccgttataataatttagtaaaattgaacagaattttttatggtttgtcgtgaatcaaaccaaactggtataaaggtttgg |
100 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
1493932 |
agaaggaaaactggaccgaactgttataataatttagtaaaactgaacagaattttttatggtttgtcgtgaatcaaaccaaactggtataaaggttcgg |
1493833 |
T |
|
| Q |
101 |
tacaccagttctgtgtttccaatcgaacgcactagaactatcattacagtaaactgaactataccttttcgaactgaactttactaaattgcttttatta |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1493832 |
tacaccagttctgtgtttccaatcgaacgcactagaactatcattacagtaaactgaactaaaccttttcgaactgaactttactaaattgcttttatta |
1493733 |
T |
|
| Q |
201 |
acttatattaggattgttaaaaagaaccaaaattttatattatgattgttgattatttaccaatgctatgacatccctagttgccaatgccaaaatgtca |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1493732 |
acttatattaggattgttaaaaagaaccaaaattttatattatgattgttgattatttaccaatgctatgacatccctagttgccaatgccaaaatgtca |
1493633 |
T |
|
| Q |
301 |
gcacatgaaaccttgttttggcagccaggtacaccatcaactgcagcctttgctt |
355 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1493632 |
gcacatgaaaccttgttttggcagccaggtacaccatcaactgcagcctttgctt |
1493578 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University