View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2832_high_9 (Length: 201)
Name: NF2832_high_9
Description: NF2832
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2832_high_9 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 19 - 190
Target Start/End: Complemental strand, 4418831 - 4418660
Alignment:
| Q |
19 |
aaaatgagatacagctagttacccacctaacaggaaagaacggatgtattgaaaacaaagttgtactatagatttttctatttacaccccccttggtgtg |
118 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4418831 |
aaaatgagatacagctagctacccacctaacaggaaagaacggatctattgaaaacaaagttgtactatagatttttctatttacaccccccttggtgtg |
4418732 |
T |
|
| Q |
119 |
atatgagtaccctattaatcaaagcatatccatgtcgttgtgattttagaaatcttttttgccctatgcttc |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
4418731 |
atatgagtaccctattaatcaaagcatatccatgtcgttgtgattttagaaatcttttttgcccaatgcttc |
4418660 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University