View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2834_high_4 (Length: 240)
Name: NF2834_high_4
Description: NF2834
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2834_high_4 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 5 - 240
Target Start/End: Original strand, 4626381 - 4626616
Alignment:
| Q |
5 |
gacagtaggaggtggacctttctccaatctaatttcttcccatggggtcggggtcttctttttgttgcaacttactctaattttagagattttttgcaca |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4626381 |
gacagtaggaggtggacctttctccaatctaatttcttcccatggggtcggggtcttctttttgttgcaacttactctaattttagagattttttgcaca |
4626480 |
T |
|
| Q |
105 |
atggcagctttattgcgatgatacaagtgagttcctagaataggatgattcacaattcgattaacatcttcgttgagatagtaacagccgcacaatacaa |
204 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4626481 |
atcgcagctttattgcgatgatacaagtgagttcctagaataggatgattcacaattcgattaacatcttcgttgagatagtaacagccgcacaatacag |
4626580 |
T |
|
| Q |
205 |
catcattctcgacattgctataactggaactacaat |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
4626581 |
catcattctcgacattgctataactggaactacaat |
4626616 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University