View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2835_high_21 (Length: 254)
Name: NF2835_high_21
Description: NF2835
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2835_high_21 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 83; Significance: 2e-39; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 148 - 238
Target Start/End: Complemental strand, 6248996 - 6248906
Alignment:
| Q |
148 |
acaattagagatcaaactcatctgatctgatattatttgtattggaattccatcaaatttgttttgattaattagttaagagggtgctatt |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
6248996 |
acaattagagatcaaactcatctgatctgatactatttgtattggaattccatcaaatttgttttgattaattagttaagagggtgttatt |
6248906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 1 - 69
Target Start/End: Complemental strand, 6249141 - 6249073
Alignment:
| Q |
1 |
tagaggagctgccatcaaatgttgctgatttgctctgatgagttaatttttgttctctgttaaatcatc |
69 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6249141 |
tagaggagctgccatcaaatgttgctgatttgctctgatgagttaatttttgttctctgttaaatcatc |
6249073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 1 - 55
Target Start/End: Complemental strand, 6240737 - 6240683
Alignment:
| Q |
1 |
tagaggagctgccatcaaatgttgctgatttgctctgatgagttaatttttgttc |
55 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| ||||||| |||||||||| |
|
|
| T |
6240737 |
tagaggagctgccatcaaattttgctgatttgctctcatgagttgatttttgttc |
6240683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 1 - 56
Target Start/End: Complemental strand, 6226396 - 6226341
Alignment:
| Q |
1 |
tagaggagctgccatcaaatgttgctgatttgctctgatgagttaatttttgttct |
56 |
Q |
| |
|
||||||||||||||| ||| ||| |||||||||||||||||||| ||||||||| |
|
|
| T |
6226396 |
tagaggagctgccatgcaattttgaagatttgctctgatgagttaaattttgttct |
6226341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 69
Target Start/End: Original strand, 42719173 - 42719241
Alignment:
| Q |
1 |
tagaggagctgccatcaaatgttgctgatttgctctgatgagttaatttttgttctctgttaaatcatc |
69 |
Q |
| |
|
||||||| |||| ||||||||||| ||| | ||||||||| |||||||||||||| |||||| ||||| |
|
|
| T |
42719173 |
tagaggaattgccttcaaatgttgccgatctactctgatgaattaatttttgttctttgttaagtcatc |
42719241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 1 - 56
Target Start/End: Original strand, 17545735 - 17545790
Alignment:
| Q |
1 |
tagaggagctgccatcaaatgttgctgatttgctctgatgagttaatttttgttct |
56 |
Q |
| |
|
||||||||||||||| ||| ||| ||| ||||||||||||||| ||||||||||| |
|
|
| T |
17545735 |
tagaggagctgccatataattttgatgagttgctctgatgagttcatttttgttct |
17545790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University