View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2835_low_14 (Length: 365)
Name: NF2835_low_14
Description: NF2835
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2835_low_14 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 329; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 329; E-Value: 0
Query Start/End: Original strand, 16 - 360
Target Start/End: Complemental strand, 36591243 - 36590899
Alignment:
| Q |
16 |
accaacttcaaaataatgttcttaatcttataataacgtacacctaacaaaattctatatatatagctcaactcttgactctctcattgtacaattcatt |
115 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
36591243 |
accaacttcaaaataatgatcttaatcttataataacgtacacctaacaaaattctatatatatagctcaactcttgactctcttattgtacaattcatt |
36591144 |
T |
|
| Q |
116 |
ttcccaaccaatataaccttttcagtcccattttctattagagtgacataacataagatattttgtggaaatggcaacatttggtgcctctgcatttcag |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36591143 |
ttcccaaccaatataaccttttcagtcccattttctattagagtgacataacataagatattttgtggaaatggcaacatttggtgcctctgcatttcag |
36591044 |
T |
|
| Q |
216 |
tttttaatgttgataatggttataggcttgttttgcgtgacaaacattgttgcacaagattcagagatcgcacccacatcacaattggagactggaactg |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36591043 |
tttttaatgttgataatggttataggcttgttttgcgtgacaaacattgttgcacaagattcggagatcgcacccacatcacaattggagactggaactg |
36590944 |
T |
|
| Q |
316 |
gatttgctttgcctatttctgggatgatcatgttttcttctctct |
360 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
36590943 |
gatttgctttgcctatttctgggatgataatgttttcttctctct |
36590899 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University