View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2835_low_21 (Length: 295)
Name: NF2835_low_21
Description: NF2835
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2835_low_21 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 4 - 272
Target Start/End: Original strand, 49038370 - 49038638
Alignment:
| Q |
4 |
tagagaattaggtagactcaatatagaattcattcccttgtttgggagagtaaagtggattgtggtgtttaattgtgcaaagatgggggatcactttgat |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49038370 |
tagagaattaggtagactcaatatagaattcattcccttgtttgggagagtaaagtggattgtggtgtttaattgtgcaaagatgggggatcactttgat |
49038469 |
T |
 |
| Q |
104 |
ttattggttgatcggttgctcactgaatcgacgttagaagctgcgattgaaagcagaaaccgtgcgatgcaggctgcgtcctcggaggtgactagcgcag |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49038470 |
ttattggttgatcggttgctcactgaatcgacattagaagctgcgattgaaagcagaaaccgtgcgatgcaggctgcgtcctcggaggtgactagcgcag |
49038569 |
T |
 |
| Q |
204 |
tagtcgatcattctttgttgaagatgggtatcaaatgttccgggaagctggcagaatgcaggatatgcc |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49038570 |
cagtcgatcattctttgttgaagatgggtatcaaatgttccgggaagctggcagaatgcaggatatgcc |
49038638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University