View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2835_low_22 (Length: 279)
Name: NF2835_low_22
Description: NF2835
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2835_low_22 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 91; Significance: 4e-44; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 141 - 260
Target Start/End: Original strand, 39237287 - 39237406
Alignment:
| Q |
141 |
atatcatacttagcctgatccctacttcagtgtctcaacgtcagcaacaatctctgcatcacctgacctgaggagnnnnnnncaaaattaatttcgtaaa |
240 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
39237287 |
atatcatacttagcctgatccttacttcagtgtctcaacgtcagcaacaatctctgcatcacctgacctgaggagaaaaaaacaaaattaatttcgtaaa |
39237386 |
T |
|
| Q |
241 |
attatttgaacactagatat |
260 |
Q |
| |
|
||||||||||||| |||||| |
|
|
| T |
39237387 |
attatttgaacaccagatat |
39237406 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 20 - 76
Target Start/End: Original strand, 39237162 - 39237218
Alignment:
| Q |
20 |
ataaaaataatatcggggtaaaaaagaaaattctacatgatcaatggattttctaag |
76 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39237162 |
ataaaaataatatcggggtaaaaaagaaaattctacatgatcaatggattttctaag |
39237218 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University