View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2835_low_25 (Length: 263)
Name: NF2835_low_25
Description: NF2835
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2835_low_25 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 17 - 246
Target Start/End: Complemental strand, 14771593 - 14771362
Alignment:
| Q |
17 |
tttaaagacgcatagtcacacataaacatctaagcagctaatagtcatcataagaaaaggcataaatgaaatgaaannnnnnn--agacactctaattga |
114 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||| |
|
|
| T |
14771593 |
tttaaagatacatagtcacacataaacatctaagcagctaatagtcatcataagaaaaggcataaatgaaatgaaaatttttcttagacactctaaatga |
14771494 |
T |
|
| Q |
115 |
aaacaattagtaattggtagattatttctcaccctgaaactgatggatttgacgacaacattatcagccattgaggaaaatgtagcactttgtgagattg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14771493 |
aaacaattagtaattggtagattatttctcaccctgaaactgatggatttgacgacaacattatcagccattgaggaaaatgtagcactttgtgagattg |
14771394 |
T |
|
| Q |
215 |
gtgcatgatcatcccattcaacaatggttttc |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
14771393 |
gtgcatgatcatcccattcaacaatggttttc |
14771362 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University