View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2835_low_36 (Length: 231)
Name: NF2835_low_36
Description: NF2835
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2835_low_36 |
 |  |
|
| [»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 184; Significance: 1e-99; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 18 - 231
Target Start/End: Original strand, 35748289 - 35748504
Alignment:
| Q |
18 |
agttcaaaccaataccatt--gtgtaaggttgaatgagttgaaatattcatgcaggctgaggtgttcaactaaacaaaaaatatatcttaactttatggc |
115 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35748289 |
agttcaaaccaataccattttgtgtaaggttgaatgagttgaaatattcatgcaggctgaggtgttcaactaaacaaaaaatatatcttaactttatggc |
35748388 |
T |
 |
| Q |
116 |
ggcttaatttatatcctctttctggagctcaatgttccaatttttattaaatgagtctttcaccnnnnnnnatacgcttttgtttcattagtgctcttgc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
35748389 |
ggcttaatttatatcctctttctggagctcaatgttccaatttttattaaatgagtctttcacctttttttatacgcttttgtttcattagtgctcttgc |
35748488 |
T |
 |
| Q |
216 |
aatttgtctcttgaac |
231 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
35748489 |
aatttgtctcttgaac |
35748504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 194 - 227
Target Start/End: Complemental strand, 35853835 - 35853802
Alignment:
| Q |
194 |
tttgtttcattagtgctcttgcaatttgtctctt |
227 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |
|
|
| T |
35853835 |
tttgtttcattagcgctcttgcaatttgtctctt |
35853802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University