View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2836_low_25 (Length: 230)
Name: NF2836_low_25
Description: NF2836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2836_low_25 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 19 - 214
Target Start/End: Original strand, 42163611 - 42163806
Alignment:
| Q |
19 |
taggtatgaatgaggggacttttccatgacaaggcgagcaagtgagacagggtttttcacggtggtaacaccagatacagcaccacatcttctctttgta |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42163611 |
taggtatgaatgaggggacttttccatgacaaggcgagcaagtgagacagggtttttcacggtggtaacaccagatacagcaccacatcttctctttgta |
42163710 |
T |
|
| Q |
119 |
ccatccatgatgctagcctccatttcaactgttccttttgctgtcaaagcagatccacgcccagaattgaacaggggatttgtttccagttctctc |
214 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42163711 |
ccatccattatgctagcctccatttcaactgttccttttgctgtcaaagcagatccacgcccagaattgaacaggggatttgtttccagttctctc |
42163806 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 98 - 206
Target Start/End: Original strand, 5480656 - 5480764
Alignment:
| Q |
98 |
gcaccacatcttctctttgtaccatccatgatgctagcctccatttcaactgttccttttgctgtcaaagcagatccacgcccagaattgaacaggggat |
197 |
Q |
| |
|
||||| |||| ||| |||| |||||||| ||||||||||||||||| || ||||||||| | |||| ||||||||||| || |||||||| || |||| |
|
|
| T |
5480656 |
gcaccgcatcgtctttttggtccatccattatgctagcctccatttccaccgttcctttttccgtcagggcagatccacgacccgaattgaatagtggat |
5480755 |
T |
|
| Q |
198 |
ttgtttcca |
206 |
Q |
| |
|
||||||| |
|
|
| T |
5480756 |
ccgtttcca |
5480764 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 114; Significance: 6e-58; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 20 - 189
Target Start/End: Complemental strand, 47170742 - 47170573
Alignment:
| Q |
20 |
aggtatgaatgaggggacttttccatgacaaggcgagcaagtgagacagggtttttcacggtggtaacaccagatacagcaccacatcttctctttgtac |
119 |
Q |
| |
|
||||| ||||||||||| |||||||||||||| |||||||| |||| || ||||||||||||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
47170742 |
aggtaggaatgaggggatttttccatgacaagacgagcaagagagattggatttttcacggtggaaacaccagatacagcaccacatcttctcttggtac |
47170643 |
T |
|
| Q |
120 |
catccatgatgctagcctccatttcaactgttccttttgctgtcaaagcagatccacgcccagaattgaa |
189 |
Q |
| |
|
|||||||||| |||||||||||||| || |||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
47170642 |
catccatgatactagcctccatttccaccgttccttttgctgtcagagcagatccacggccagaattgaa |
47170573 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University