View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2836_low_8 (Length: 424)
Name: NF2836_low_8
Description: NF2836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2836_low_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 153; Significance: 6e-81; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 153; E-Value: 6e-81
Query Start/End: Original strand, 254 - 418
Target Start/End: Original strand, 39929111 - 39929275
Alignment:
| Q |
254 |
ttccgaatccaatactgatgtcttttaagtctcttcactcgtttcttgtgctttattaatcttcttcatgggtttttgaagcacgtgagagaagtacata |
353 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39929111 |
ttccgaatccaatactgatgtcttttaagtctcttcactcgtttcttgtgctttattaaccttcttcatgggtttttgaagcacgtgagagaagtacata |
39929210 |
T |
 |
| Q |
354 |
ttgctcttgttgccagccacttatacatcttttcccctattggctgtttgatgaagaattatcta |
418 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
39929211 |
ttgctcttgttgccagccacttatacatcttttcccctattggttgtttgatgaagagttatcta |
39929275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 19 - 143
Target Start/End: Original strand, 39928890 - 39929010
Alignment:
| Q |
19 |
gttaacatttcaattaagataatttacttataaatatattgtctg-ctgtcttatcaacacataaaagatgctctcaatgaaagttaattcaggatggga |
117 |
Q |
| |
|
||||| |||||| |||| ||||||||||||||||||||||||| | ||||||||||||||| ||||||||| |||||||| ||||||||||||| |
|
|
| T |
39928890 |
gttaatatttcagttaaaataatttacttataaatatattgtccgtctgtcttatcaacaccgaaaagatgcc-----tgaaagttcattcaggatggga |
39928984 |
T |
 |
| Q |
118 |
atcaactaattttttgcttggaatag |
143 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
39928985 |
atcaactaattttttgcttggaatag |
39929010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 162 - 200
Target Start/End: Original strand, 39929025 - 39929063
Alignment:
| Q |
162 |
aatacaactaaagattatgtcattttgatgttttaaagg |
200 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
39929025 |
aatacaactaaagattttgtcattttgatgttttaaagg |
39929063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University