View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2837_high_32 (Length: 266)
Name: NF2837_high_32
Description: NF2837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2837_high_32 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 13 - 266
Target Start/End: Original strand, 3448733 - 3448986
Alignment:
| Q |
13 |
aatatcataaggcgcttgaattctcttcgaaaacgtgaaaacttcatcgtcatccatattactaagcactcttaattctttcatcaaacaccttacgtgc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||| |
|
|
| T |
3448733 |
aatatcataaggcgcttgaattctcttcgaaaacgtgaaaacttcatcgtcatccatattactaagcactctcaattctttcatcaaacaccttacatgc |
3448832 |
T |
 |
| Q |
113 |
attacagttttcgcaatgttacctgaatttttcacctctccttgaatccttatcatcgctgcaccttctctgattctacagagcgcttcaccgagattac |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3448833 |
attacagttttcgcaatgttacctgaatttttcacctctccttgaatccttatcatcgctgcaccttctctgattctacagagcgcttcaccgagattac |
3448932 |
T |
 |
| Q |
213 |
ttgcggagcttataaaaggtgttcggaaattgtgtttgttgatgtgattctgat |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3448933 |
ttgcggagcttataaaaggtgttcggaaattgtgtttgttgatgtgattctgat |
3448986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University