View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2837_high_33 (Length: 266)

Name: NF2837_high_33
Description: NF2837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2837_high_33
NF2837_high_33
[»] chr8 (2 HSPs)
chr8 (148-256)||(43369390-43369498)
chr8 (47-88)||(43369558-43369599)


Alignment Details
Target: chr8 (Bit Score: 109; Significance: 7e-55; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 109; E-Value: 7e-55
Query Start/End: Original strand, 148 - 256
Target Start/End: Complemental strand, 43369498 - 43369390
Alignment:
148 atttttccaccggtaatttctccctctctctcaatttattcttaattgcaacctttctttacttctcataatcatatagttagttttgttttctgaacta 247  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43369498 atttttccaccggtaatttctccctctctctcaatttattcttaattgcaacctttctttacttctcataatcatatagttagttttgttttctgaacta 43369399  T
248 aaaattctg 256  Q
    |||||||||    
43369398 aaaattctg 43369390  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 47 - 88
Target Start/End: Complemental strand, 43369599 - 43369558
Alignment:
47 actcaactcaactgctatggtgagagtaattcccatcgctag 88  Q
    ||||||||||||||||||||||||||||||||||||||||||    
43369599 actcaactcaactgctatggtgagagtaattcccatcgctag 43369558  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University