View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2837_high_33 (Length: 266)
Name: NF2837_high_33
Description: NF2837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2837_high_33 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 109; Significance: 7e-55; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 109; E-Value: 7e-55
Query Start/End: Original strand, 148 - 256
Target Start/End: Complemental strand, 43369498 - 43369390
Alignment:
| Q |
148 |
atttttccaccggtaatttctccctctctctcaatttattcttaattgcaacctttctttacttctcataatcatatagttagttttgttttctgaacta |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43369498 |
atttttccaccggtaatttctccctctctctcaatttattcttaattgcaacctttctttacttctcataatcatatagttagttttgttttctgaacta |
43369399 |
T |
 |
| Q |
248 |
aaaattctg |
256 |
Q |
| |
|
||||||||| |
|
|
| T |
43369398 |
aaaattctg |
43369390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 47 - 88
Target Start/End: Complemental strand, 43369599 - 43369558
Alignment:
| Q |
47 |
actcaactcaactgctatggtgagagtaattcccatcgctag |
88 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43369599 |
actcaactcaactgctatggtgagagtaattcccatcgctag |
43369558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University