View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2837_high_34 (Length: 265)
Name: NF2837_high_34
Description: NF2837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2837_high_34 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 109; Significance: 6e-55; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 107 - 248
Target Start/End: Original strand, 8176564 - 8176704
Alignment:
| Q |
107 |
gaaatttcagaataataacatttactaggaaaaatatgacctcnnnnnnngtttatatttgagtccggagaaatacctgaacggttgctcgcaatccaaa |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8176564 |
gaaatttcagaataataacatttactaggaaaa-tatgacctctttttttgtttatatttgagtccggagaaatacctgaacggttgctcgcaatccaaa |
8176662 |
T |
 |
| Q |
207 |
tgctttaactgcaattataatgttaggattcccagcccattt |
248 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
8176663 |
tgctttaactgcaactataatgttaggattcccagcccattt |
8176704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 21 - 87
Target Start/End: Original strand, 8176428 - 8176494
Alignment:
| Q |
21 |
gaaccaaaggcttcaacattatgcgcggagaagcaaacacttgcaaatcaacaacctgcaatcattt |
87 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8176428 |
gaaccaaaggcttcaacattatgcgcggagaagcaaacacttgcaaatcaacaacctgcaatcattt |
8176494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University