View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2837_high_48 (Length: 239)
Name: NF2837_high_48
Description: NF2837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2837_high_48 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 176; Significance: 6e-95; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 1 - 208
Target Start/End: Complemental strand, 36936251 - 36936045
Alignment:
| Q |
1 |
ctatgtcgagtttgttgttattgcattcaatttgtcgaaaaaccctaaatgtgtttgaccttttggaattgcatcctgaggacattgctaatgtgagatg |
100 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36936251 |
ctatgtcgagtttgttgttattgtgttcaatttgtcgaaaaaccctaaatatgtttgaccttttggaattgcatcctgaggacattgctaatgtgagatg |
36936152 |
T |
|
| Q |
101 |
tctccagcctcgatctcttctacaaccatctaatggtcactttcgagacttcctgtagtcaatctgagcatacaaaaaccaaagaaaataattcataacc |
200 |
Q |
| |
|
|||||| ||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
36936151 |
tctccaacctcgatctcttctaaaaccatctaatggtcactttcgagactacctgtagtcaatctgagcatacaaaaaccaaag-aaataattcataacc |
36936053 |
T |
|
| Q |
201 |
gagcaaga |
208 |
Q |
| |
|
|||||||| |
|
|
| T |
36936052 |
gagcaaga |
36936045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 54 - 106
Target Start/End: Complemental strand, 36957044 - 36956993
Alignment:
| Q |
54 |
tttgaccttttggaattgcatcctgaggacattgctaatgtgagatgtctcca |
106 |
Q |
| |
|
||||||||| || ||||||| |||||||| |||||||||| |||||||||||| |
|
|
| T |
36957044 |
tttgaccttctgaaattgca-cctgaggatattgctaatgcgagatgtctcca |
36956993 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University