View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2837_high_49 (Length: 237)
Name: NF2837_high_49
Description: NF2837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2837_high_49 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 15 - 220
Target Start/End: Complemental strand, 33719117 - 33718912
Alignment:
| Q |
15 |
cacagaggagcaaaagtatttcaagctgacaagtacaggaagggagcatatgaaaagtaagtggacttctgctgttttaaatatcaaaataatgtcacaa |
114 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
33719117 |
cacaaaggagcaaaagtatttcaagctgacaagtacaggaagggagcatatgaaaagtaagtggacttctgctgttttaaatatcaatataatgtcacaa |
33719018 |
T |
 |
| Q |
115 |
gtgctagattcttggtttccctagccaactggtccagggttcaatgtctggtcggtgtgtatgaaaaaacatatgttgagatatcaaccccttaaatgta |
214 |
Q |
| |
|
|||||||||||||||||||| | ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33719017 |
gtgctagattcttggtttcctttgccaattggtccagggttcaatgtctggtcggtgtgtatgaaaaaacatatgttgagatatcaaccccttaaatgta |
33718918 |
T |
 |
| Q |
215 |
gtccct |
220 |
Q |
| |
|
|||||| |
|
|
| T |
33718917 |
gtccct |
33718912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University