View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2837_high_51 (Length: 233)
Name: NF2837_high_51
Description: NF2837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2837_high_51 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 16 - 216
Target Start/End: Complemental strand, 6977218 - 6977018
Alignment:
| Q |
16 |
atgaaggtatatgaaatgtatattatgtttaactgtttaaggtctagtttggattagcttttagattgttagaggttatgagttgatgatttttcacttg |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6977218 |
atgaaggtatatgaaatgtatattatgtttaactgtttaaggtctagtttgtattagcttttagattgttagaggttatgagttgatgatttttcacttg |
6977119 |
T |
 |
| Q |
116 |
tgaaataatccatataagcttatagtatggagaatttagggcatgtttgaattagattatttgagcttatttattagcatgagaacttgtgaggctgttt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6977118 |
tgaaataatccatataagcttatagtatggagaatttagggcatgtttgaattagattatttgagcttatttattagcatgagaacttgtgaggctgttt |
6977019 |
T |
 |
| Q |
216 |
g |
216 |
Q |
| |
|
| |
|
|
| T |
6977018 |
g |
6977018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 148 - 205
Target Start/End: Original strand, 35378440 - 35378497
Alignment:
| Q |
148 |
aatttagggcatgtttgaattagattatttgagcttatttattagcatgagaacttgt |
205 |
Q |
| |
|
||||||||||||||||| ||| | |||||||||||||| || |||||| || |||||| |
|
|
| T |
35378440 |
aatttagggcatgtttggattggcttatttgagcttatataatagcataagcacttgt |
35378497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University