View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2837_high_52 (Length: 221)
Name: NF2837_high_52
Description: NF2837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2837_high_52 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 18 - 186
Target Start/End: Complemental strand, 2214409 - 2214241
Alignment:
| Q |
18 |
gtttaaggatatgttgcactggtttaatttttctgaaattacgtgggttgatttgggttttcactaattggattgggttcttaaaatatggattagattt |
117 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
2214409 |
gtttaaggatatattgtactggtttaatttttctgaaattacgtgggttgatttgggttttcactaattggattgggttcttaaaatatggattaggttt |
2214310 |
T |
 |
| Q |
118 |
gctaatgttgttgattttaaggatgtggttgtgnnnnnnnattatgatgtggtggaaagaactaaaggg |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
2214309 |
gctaatgttgttgattttaaggatgtggttgtgttttttgattatgatgtggtggaaagaactaaaggg |
2214241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 18 - 209
Target Start/End: Complemental strand, 21843644 - 21843452
Alignment:
| Q |
18 |
gtttaaggatatgttgcactggtttaatttttctgaaattacgtgggttgatttgggttttcactaattggattgggttcttaaaatatggattagattt |
117 |
Q |
| |
|
||||||||||||| | ||| ||||||||||| ||||||| |||||||||||||| ||||||||| |||||||||||| |||||||||||||||| ||| |
|
|
| T |
21843644 |
gtttaaggatatgctaaactagtttaattttttagaaattatgtgggttgatttggtttttcactagttggattgggtttttaaaatatggattaggttt |
21843545 |
T |
 |
| Q |
118 |
gctaatgttgttgattttaaggatgtggttgtgnnnnnnnattatgatgtggtggaaagaa-ctaaagggaagaagaaaggggaggtgatggt |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||| | ||| ||||||||||| ||||||||||||| |
|
|
| T |
21843544 |
gctaatgttgttgattttaaggatgtggttgtgttttttgattatgatgtggtggaaagaacccaaatggaagaagaaaagggaggtgatggt |
21843452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University