View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2837_low_16 (Length: 387)
Name: NF2837_low_16
Description: NF2837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2837_low_16 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 9 - 369
Target Start/End: Original strand, 44510438 - 44510786
Alignment:
| Q |
9 |
gagatgaaccgtgatgcaacatcaccacagcttggaccaatcaatactgttcaaagaagtcgttccaacggtggaggacgtggttaccgtaccggaaaag |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44510438 |
gagatgaaccgtgatgcaacatcaccacagcttggaccaatcaatactgttcaaagaagtcgttccaacggtggaggacgtggttaccgtaccggaaaag |
44510537 |
T |
|
| Q |
109 |
tttctccggcgattgagccaccgtctcctaggatttctgcttgtgggttttgtggtgcttttgggaaagttggagagaaaaggaaaccacctaagcatcg |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44510538 |
tttctccggcgattgagccaccgtctcctaggatttctgcttgtgggttttgtggtgcttttgggaaagttggagagaaaaggaaaccacctaagcatcg |
44510637 |
T |
|
| Q |
209 |
atcaaggtagnnnnnnnnnnnnnnnnnnnactgttttgttgtatttgtcggtggtttgaagcgttaccggagatgggatattccggggaaggtaaaaggt |
308 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
44510638 |
atcaaggtag---------ttttttttttactgttttgttgtatttgtcggtggtttgaagcgttaccggagatgggatattccggggaaggtgaaaggt |
44510728 |
T |
|
| Q |
309 |
tgatgctcttttgtgtaatggtaattacttaattagtaattagttacttcaggtttgtggg |
369 |
Q |
| |
|
| ||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
44510729 |
ttatgctcttttgtgtaatggtaattacttaat---taattagttactttaggtttgtggg |
44510786 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 60 - 176
Target Start/End: Complemental strand, 2600805 - 2600689
Alignment:
| Q |
60 |
caaagaagtcgttccaacggtggaggacgtggttaccgtaccggaaaagtttctccggcgattgagccaccgtctcctaggatttctgcttgtgggtttt |
159 |
Q |
| |
|
|||||||| | ||||| ||||| ||| | || |||||||||||||||||||| || ||||| || ||||||||||| | | | || || ||||| || | |
|
|
| T |
2600805 |
caaagaagccattccaccggtgctggaagaggataccgtaccggaaaagtttcaccagcgatcgaaccaccgtctccaaaggtctccgcgtgtggattct |
2600706 |
T |
|
| Q |
160 |
gtggtgcttttgggaaa |
176 |
Q |
| |
|
|| || ||||||||||| |
|
|
| T |
2600705 |
gtagtccttttgggaaa |
2600689 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University