View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2837_low_28 (Length: 320)
Name: NF2837_low_28
Description: NF2837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2837_low_28 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 18 - 301
Target Start/End: Complemental strand, 32672968 - 32672685
Alignment:
| Q |
18 |
cttatgatgtaagaacactccagcatatagctgatcacacatcttttcccttgaagatttatcaaccggtgaatctgcatccttcaatatgtgctcatag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32672968 |
cttatgatgtaagaacactccagcatatagctgatcacacatcttttcccttgaagatttatcaaccggtgaatctgcatccttcaatatgtgctcatag |
32672869 |
T |
 |
| Q |
118 |
ttgtgtggcaaacttagttctttgatcaaaggtttggttgctgattgagtctcattggattttacaactgtggagttttgtaccgccttcttgctggagg |
217 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32672868 |
ttgtgtgacaaacttagttctttgatcaaaggtttggttgctgattgagtctcatcgcattttacaactgtggagttttgtaccgccttcttgctggagg |
32672769 |
T |
 |
| Q |
218 |
gtgattttgtgtgatgttgaggagacaacaacagattttcccttctcgaaggtaatcgtaattcttccttattggttggttcat |
301 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32672768 |
gtgattttgtgtgatattgaggagacaacaacagattttcccttctcgaaggtaatcgtaattcttccttattggttggttcat |
32672685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University